Archives

  • 2019-10
  • 2019-11
  • 2020-03
  • 2020-07
  • 2020-08
  • 2021-03
  • br primer CTGGATCCAAGACCAGGGTG and reverse GTGAGGAC TCCAGCCA

    2019-10-21


    primer 5′-CTGGATCCAAGACCAGGGTG-3′ and reverse 5′-GTGAGGAC TCCAGCCACAAA-3′, product length 145 bps; Caspase-3 forward primer 5′-AGCTTGGAACGGTACGCTAA-3′ and reverse 5′-CCACTGACTTGCTC CCATGT-3′, product length 145 bps; Caspase-9 forward primer 5′-CAC CTTCCCAGGTTGCCAAT-3′ and reverse 5′- CAAGCCATGAGAGCTTC GGA-3′, product length 156 bps; and GAPDH forward primer 5′- GGA GAGTGTTTCCTCGTCCC-3′, and reverse 5′-ATGAAGGGGTCGTTGAT GGC-3′, product length 136 bps (Tm 60 °C). The fluorescence signal was determined at the end of each cycle and the results analyzed with the 2−△△CT method.
    2.9. Confocal laser scanning microscopy (CLSM) and flow cytometry
    The uptake of [email protected] NPs and NPs without FA ([email protected]) by breast tumor MDA-MB-231 cells and control HUVEC cells were analyzed with CLSM and flow cytometry. Cells were maintained in a 5% CO2 SPDP at 95% relative humidity and 37 °C, and detached after reaching 70–80% confluence. For CLSM work, cells were seeded on culture slides (with 1 × 105 cells in 2 mL medium added per well of a 24-well plate) and incubated for 24 h at 37 °C. Free DOX solutions (dissolved in 1% DMSO, 99% PBS) or [email protected] NP suspen-sions (dispersed in PBS) were prepared at 50 μg/mL DOX concentration, then 1 mL of a DOX-containing medium added per well. After incuba-tion for 2 h, the cells were washed with PBS (pH 7.4) three times and fixed with a 4% (v/v) aqueous formaldehyde solution for 10 min. The nuclei were then stained with DAPI (100 mg/mL, 80 µL/well), and the cells examined by CLSM (FV1000, Olympus, Tokyo, Japan).
    For flow cytometry, after the incubation with free DOX or [email protected] NPs, the cells were collected, washed three times with PBS and then resuspended in PBS (1 × 106 cells/mL). Flow cytometry was performed on a Accuri C6 instrument (Beckton-Dickson, Franklin Lakes, NJ, USA). 10,000 events were collected for each sample.
    2.10. In vitro hemolysis assay
    Hemolytic activity was assessed in SPDP order to determine the phar-macological safety of the NPs using rat red blood cells (RBCs) collected on heparin. Blood was obtained from male Sprague-Dawley (SD) rats and red blood cells (RBCs) were separated by centrifuging the blood at 1,500 rpm for 15 min. RBC were then resuspended in cold saline at a 2% (w/v) concentration. DOX, OA, FA-CS-g-OA and [email protected] were serially diluted to different concentrations and incubated with the RBCs for 30 min or 120 min at 37 °C. Intact RBCs were subsequently separated by centrifugation (1500 rpm, 10 min) and the supernatant was collected. The amount of hemoglobin release was determined by reading the absorbance at 540 nm in a microplate reader (PowerWave XS, Bio-Tek, Winooski, VT, USA). The controls for zero (blank) and 100% hemolysis were comprised of RBCs suspended in PBS and 1% w/v Triton X-100, respectively. Each experiment was conducted in tripli-cate.
    2.11. In vivo pharmacokinetic study
    The pharmacokinetics of DOX or OA release from [email protected] DOX NPs were evaluated in male SD rats (200–220 g). Rats were fasted overnight, with free access to water, before the experiment. All ex-perimental protocols were approved by the Animal Care and Use Committee of the Kunming Medical University. Free DOX (dissolved in 1% v/v DMSO in PBS) or PBS suspensions of [email protected] (7.5 mg DOX equiv. kg−1) were administered by intravenous injection through the tail vein. Blood was collected from the ocular vein at predetermined time points (0, 5, 30 min; 1, 2, 3, 4, 8, 12, 16, 20 and 24 h). The blood samples were centrifuged at 12,000 rpm for 15 min at 4 °C and aliquots (100 μL) of the supernatant stored at −70 °C. The concentration of DOX